1x pcr buffer (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher 1x pcr buffer
1x Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+buffer/Tween+20/pmc13116405-70-13-45
Average 99 stars, based on 1 article reviews

1x pcr buffer - by Bioz Stars, 2026-09

99/100 stars

Images

Amplification:

Article Title: Targeting Yellow-Fever Virus: Development of a specific aptamer to NS1 protein.
Article Snippet: Yellow Fever Virus (YFV), a mosquito-borne flavivirus, remains a significant public health concern despite the availability of effective vaccines.. Accurate differential diagnosis continues to be challenging due to the high antigenic similarity among flaviviruses such as dengue and Zika, which compromises the specificity of current serological assays.. Aptamers have emerged as promising alternatives to antibodies for diagnostic applications because of their high specificity, thermal stability, and ease of synthesis.

Polymerase Chain Reaction:

Article Title: Mercury exposure, epigenetic modifications, and genetic susceptibility: insights from molecular docking and population analysis
Article Snippet: .. Each 30 μL PCR reaction contained 200 ng of genomic DNA, 1 × PCR buffer (10 mM Tris–HCl, 50 mM KCl), 2.5 mM MgCl2, 0.2 mM dNTPs, 1.5 μL of DMSO, 10 pmol of each primer, and 1 U of Taq DNA polymerase (Fermentas). ..

Article Title: DNA Barcoding for the Identification of Swim Bladders: An Approach to International Trade Monitoring
Article Snippet: .. PCR reactions were conducted in a thermocycler - ProFlex PCR System (Applied Biosystems) at a total volume of 14 μl, including 1 μl of genomic DNA (10–30 ng/μl); 1.25 μl of 1 × PCR buffer (20 mM Tris-HCl, pH 8.4, and 50 mM KCl); 0.38 μl of 1.5 mM MgCl2; 150 μM of each dNTP in a final volume of 1.5 μl; 0.2 μl of Taq polymerase (Invitrogen, Brazil); 0.75 μl with a concentration of 10 nmol/μl of each primer and 8.2 μl of Milli-Q H2O. .. The cycling conditions were an initial denaturation of 95oC for 5 min followed by 35 cycles at 95◦C for 30 s; 52◦C for 30 s; 72◦C for 45 s and a final extension of 72◦C for 5 min. Before sequencing, PCR products were purified using the enzyme kit “Exo-SAP IT” (USB Corporation, Brazil).

Article Title: Swabbing as a Non‐Lethal DNA Collection Method for Earthworm Barcoding: Performance and Citizen Science Perspectives
Article Snippet: Amplification was carried out through a polymerase chain reaction (PCR) with a final volume of 14 μL, including 1 μL of extracted DNA (average DNA concentrations: ~119 ng/μL for undiluted Tissue‐Chelex extracts, ~106 ng/μL for undiluted Tissue‐QIAGEN extracts, and ~4 ng/μL for Swab‐QIAGEN extracts; all rounded to the nearest whole number) and 13 μL of PCR reagents. .. The reaction mixture contained 1.5 μL PCR buffer (0.7 M Tris–HCl, 0.175 M (NH 4 ) 2 SO 4 , 0.2% w/v Tween‐20; HOT FIREPol 10× Buffer B2, Solis BioDyne, Tartu, Estonia), 1.5 μL MgCl 2 (25 mM; Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA), 1 μL dNTPs (2.5 mM each; Thermo Fisher Scientific Inc.), 0.2 μL Hot Start Taq Polymerase (5 U/μL; HOT FIREPol, Solis BioDyne), 6.8 μL DNA‐grade H 2 O, and 1 μL of each forward and reverse primers (5 pmol/μL each; synthesized by Sigma‐Aldrich, Darmstadt, Germany). .. Thermocycler (TProfessional Thermocylcer 96 Gradient, Biometra, Jena, Germany) settings were adjusted to include an initial denaturation at 95°C (15 min) and 35 cycles of denaturation at 94°C (1 min), annealing at 50°C (1 min), and extension at 72°C (1 min), with a final extension at 72°C (20 min), before pausing at 16°C.

Article Title: Sensitive detection of plasma interferon regulatory factor-5 (IRF5) by solid-phase proximity ligation assay validates IRF5 high and low subgroups in patients with systemic lupus erythematosus.
Article Snippet: The PLA buffer consisted of the following reagents: 0.1% bovine serum albumin (BSA) (Sigma), 1 mM biotin (Thermo Fisher Scientific, Waltham, MA, USA), 100 nM goat immunoglobulin G (IgG) (SigmaAldrich, St. Louis, MO, USA), 100 μg/mL salmon sperm DNA (Invitrogen), phosphate-buffered saline (PBS), 0.05% Tween20 (Sigma), 0.02% NaN3, and 5 mM EDTA. .. The ligation and PCR mix included: PCR buffer (Invitrogen, Carlsbad, CA, USA), 2.5 mM MgCl, 200 μM dNTPs (dATP + dUTP + dCTP + dGTP) (Thermo Scientific), 80 μM ATP (Thermo), 100 nM connector oligonucleotide with sequence TACTTAGACACGACACGATTTAGTTT (IDT), 100 mM forward primer with sequence CATCGCCCTTGGACTACGA (Integrated DNA Technologies, Coralville, IA, USA), 100 nM reversed primer with sequence GGGAATCAAGGTAACGGACTTTAG (IDT), 0.5 × SYBR Green I (Sigma) [diluted in dimethylsulfoxide (DMSO)], 0.01 U/μL T4 DNA ligase (Thermo Scientific), 0.03 U/μL Taq Platinum polymerase (Invitrogen), and 0.002 U/μL uracil N-glycosylase (Thermo Scientific). .. Oligonucelotide 3'-free PLA-arm (azide-5'-CGCA TCGCCCTTGGACTACGACTGACGAACCGCTTT GCCTGACTGATCGCTAAATCGTG-3’) and oligonucelotide 5'-free PLA-arm (phosphate -5'- TCGTGTCTAAAGTCCGTTACCTTGATTCCCC TAACCCTCTTGAAAAATTCGGCATCGGTGA-3’azide) were obtained from IDT.

Article Title: First report of 'Candidatus Anaplasma camelii' and high molecular prevalence of Anaplasma marginale in dromedary camels (Camelus dromedarius) from Somalia.
Article Snippet: .. The reaction mixture included 1.25 U of Go Hot Taq DNA Polymerase (Promega®, Madison, Wisconsin, USA), PCR buffer (10×, 100 mM Tris-HCl, pH 9.0, 500 mM KCl), 0.2 mM of each deoxynucleotide (dATP, dTTP, dCTP, and dGTP) (Invitrogen®, Carlsbad, CA, USA), 1.5 mM Magnesium Chloride (Promega®, Madison, Wisconsin, USA), 0.5 μM of each primer (Invitrogen®, Carlsbad, CA, USA), and sterile ultrapure water (Promega®, Madison, Wisconsin, USA). .. DNA from A. phagocytophilum was used as the positive control, while ultrapure sterile water (Promega®, Madison, Wisconsin, USA) served as the negative control in all PCR assays. alkaline phosphatase, P-nitrophenyl phosphate (Sigma®, St. Louis, MO, USA), diluted to 1 mg/mL in diethanolamine buffer (pH 9.8; Sigma®, St. Louis, USA), was added.

Article Title: Lack of genome elimination in adult hybrid males of the European water frog complex.
Article Snippet: Sexual reproduction is a universal trait of all eukaryotes.. It involves the formation of reduced and recombined gametes, followed by their fusion to restore the parental genome constitution (Lenormand et al., 2016).. While sexual reproduction can take different forms in various organisms, in vertebrates, it typically requires two individuals of different sexes.

Article Title: Fungal diversity in larval diets of Melipona interrupta : Impacts on queen development and survival
Article Snippet: .. PCR reactions were performed in a VeritiTM 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA) with a reaction mixture containing 1× PCR buffer (Thermo Fisher Scientific), 2.5 mM MgCl2, 0.2 mM dNTP mix (Thermo Fisher Scientific), 0.5 μM of each primer, 1 U of Taq DNA polymerase (Thermo Fisher Scientific), and 2 μL of DNA template in a final volume of 25 μL. .. The cycling conditions included an initial denaturation at 94 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 53 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. PCR products were resolved on 1% agarose gels in 1× TBE buffer (Thermo Fisher Scientific) at 100V for 45 minutes.

Review

1x pcr buffer (Thermo Fisher)

Structured Review

Images

Related Articles

Amplification:

Polymerase Chain Reaction:

Concentration Assay:

Synthesized:

Ligation:

Sequencing:

SYBR Green Assay:

Sterility:

Similar Products

Image Search Results